Figure 1

Analysis of polymorphisms in the 15r3 and ITS2 gene sequences of L. loa: Panel A: Pairwise differences in 15r3 amplicon sequences among L. loa isolates. The 15R3 gene fragment was amplified from L. loa genomic DNA (2.5 μl per reaction) using primers with the sequences 5' GGCACAAAACACTGCAGCAGTCCT 3' and 5' CAGCTGTCTCAAATCGAAGATTCT 3'. A total of 2.5 units of Taq polymerase (Roche Applied Biochemicals, Indianapolis, USA) was used in each 50 μl amplification reaction, together with the reaction buffer supplied by the manufacturer. Amplification conditions consisted of an initial denaturation of 5 minutes at 94°C, followed by 40 cycles consisting of 1 minute at 94°C, 1 minute at 49°C, and 2 minutes at 72°C. Reactions were completed by a final extension at 72°C for 7 minutes. The amplicon analyzed was 318 nucleotides long. Distances were calculated using the two parameter method [28]. Panel B: Pairwise differences in ITS2 amplicon sequences among L. loa isolates. The ITS2 gene fragment was amplified from L. loa genomic DNA (2.5 μl per reaction) using primers with the sequences 5' TAACAATGAAGATAAAGCGA 3' and 5' TTAGTTTCTTTTCCTCCGCT 3'. A total of 2.5 units of Taq polymerase (Roche Applied Biochemicals, Indianapolis, USA) was used in each 50 μl amplification reaction, together with the reaction buffer supplied by the manufacturer. Amplification conditions consisted of an initial denaturation of 5 minutes at 94°C, followed by 40 cycles consisting of 1 minute at 94°C, 1 minute at 50°C, and 2 minutes at 72°C. Reactions were completed by a final extension at 72°C for 7 minutes. The amplicon analyzed was 472 nucleotides long. Distances were calculated using the two parameter method [28]. Panel C: Phylogenetic tree developed from the ITS2 sequence data. The phylogeny was developed using parsimony methods, performing an exhaustive search of the data with the parsimony routines in the PAUP program package (v4.0, release 10) [29]. The robustness of the phylogeny was tested by running 1000 synthetic datasets with the bootstrap method in the PAUP program package. As indicated on the figure, the division of the four sequences into the two clades shown was supported 70% of the time in the bootstrap analysis.